US PCT/US2022/054260 2022-12-29 19520-005WO1 US 63/295,348 2021-12-30 THE REGENTS OF THE UNIVERSITY OF CALIFORNIA Methods for Improving Protein Delivery to Plant Cells by Biolistics Métodos para mejorar la administración de proteínas a las células vegetales mediante biolística 239 27 RNA PAT source 1..27 mol_type other RNA organism synthetic construct construcción sintética taaaggaaccaattcagtcgactggat 39 RNA PAT source 1..39 mol_type other RNA organism synthetic construct construcción sintética gccctgcaggtctagatatctcgagggtaccaaactgag 48 RNA PAT source 1..48 mol_type other RNA organism synthetic construct construcción sintética cgggtctcacttggcgatgtcttggtctgcttgacaaagcaccagtgg 32 RNA PAT source 1..32 mol_type other RNA organism synthetic construct construcción sintética taggtctcaaggtggtcattgcaccagccggg 38 RNA PAT source 1..38 mol_type other RNA organism synthetic construct construcción sintética cgggtctccaccttcttttcagcgttttagagctagaa 54 RNA PAT source 1..54 mol_type other RNA organism synthetic construct construcción sintética taggtctccaaacgcgatggagcgacagcaaacaaaaaaaaaagcaccgactcg 33 RNA PAT source 1..33 mol_type other RNA organism synthetic construct construcción sintética cgggtctcacttggcgatgtcttggtctgcttg 33 RNA PAT source 1..33 mol_type other RNA organism synthetic construct construcción sintética taggtctccaaacgcgatggagcgacagcaaac 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética gaccaaagcctgtctatctgcatt 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética agacgtcgacgatgaggatctcct 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gctcttccgatctccatgtcacccgaagccatg 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gctcttccgatctgcgactgcgagcacttacag 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct construcción sintética aactatgattgctttgccgg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct construcción sintética ggcggccagcaattagca 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct construcción sintética tgaaaataccattgcttggtca 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética cacgtcaatgcagtccaaagc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética ctcggtgcgatatgaccgaataa 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética ccacatcaatgtagtccatgc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética tcgaaaagttcgacagcgtct 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética agctgcatcatcgaaattgcc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética aacggccacgagttcgagatc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct construcción sintética gctccacgatggtgtagtcc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética ctcgaaattttcccaaccgctcg 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct construcción sintética acagagttggtgccgatgtcca 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética atggttagttgatttaaaggg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética ctttgtcctaagctattacga 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética aatgtttggttgtaagttaag 22 DNA PAT source 1..22 mol_type other DNA organism synthetic construct construcción sintética tattacgggttattatcatcag 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética aatgtttggttctaagttaac 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct construcción sintética ctttgtcctaagctattacgg 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttcttttcagcaggtatgtc 27 DNA PAT source 1..27 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttctttagcaggtatgtc 10 DNA PAT source 1..10 mol_type other DNA organism synthetic construct construcción sintética atggtatgtc 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttctagcaggtatgtc 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttcttttaggtatgtc 16 DNA PAT source 1..16 mol_type other DNA organism synthetic construct construcción sintética atgaccacggtatgtc 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttcttttcaagcaggtatgtc 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética atgaccacctttagcaggtatgtc 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttcagcaggtatgtc 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttcttttcgagcaggtatgtc 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct construcción sintética atgaccaccttctagcaggtatgtc 23 RNA PAT source 1..23 mol_type other RNA organism synthetic construct construcción sintética atgaccaccttcttttcagcagg 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética acaacagggtgatcgtgcgcggg 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética acaacagggtgatcgtgacgcggg 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct construcción sintética acaacagggtgatcgtggcgcggg 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct construcción sintética gttctacggcaccgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct construcción sintética gttctacggcaccgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcataggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcataggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctgtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctgtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcagtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcagtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcataggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcataggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcagcgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcataggtacggtaccgggtac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct construcción sintética gttctacggcaccgggtac 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctgtacggcagcgggtac 42 DNA PAT source 1..42 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcagtacggcagcgggtac 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct construcción sintética gttctacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggcaccgggtac 46 DNA PAT source 1..46 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctggcactgcatagggtacggtaccgggtac 33 DNA PAT source 1..33 mol_type other DNA organism synthetic construct construcción sintética gttccacggcgagctctgtacggcagcgggtac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct construcción sintética gttccacgtacggcaccgggtac 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcagtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcagtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcaccgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcagtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcagtacggcagcgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcagtacggcagcgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtagg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtagg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggtaccgggtacgggtagg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagtacggtaccgggtacgggtagg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggtaccgggtacgggtatg 49 DNA PAT source 1..49 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcatagggtacggcaccgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 45 DNA PAT source 1..45 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcggtacggcagcgggtacgggtatg 48 DNA PAT source 1..48 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggtacggcagcgggtacgggtatg 47 DNA PAT source 1..47 mol_type other DNA organism synthetic construct construcción sintética cacggcgagctctggcactgcataggacggcaccgggtacgggtagg 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatatattagtagacagttccatggtgcctaaa 47 RNA PAT source 1..47 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatattagtagacagttccatggtgcctaaa 48 RNA PAT source 1..48 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaataattagtagacagttccatggtgcctaaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatattattagtagacagttccatggtgcctaa 44 RNA PAT source 1..44 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccattagtagacagttccatggtgcctaaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaataaattagtagacagttccatggtgcctaaa 000 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatatattagtagacagttccatggtgcctaaa 47 RNA PAT source 1..47 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatattagtagacagttccatggtgcctaaa 48 RNA PAT source 1..48 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaattattagtagacagttccatggtgcctaaa 48 RNA PAT source 1..48 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaataattagtagacagttccatggtgcctaaa 46 RNA PAT source 1..46 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatttagtagacagttccatggtgcctaaa 44 RNA PAT source 1..44 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccattagtagacagttccatggtgcctaaa 48 RNA PAT source 1..48 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatatttagtagacagttccatggtgcctaaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatactattagtagacagttccatggtgcctaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatattattagtagacagttccatggtgcctaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética gatctgaagcctgccaataatattagtagacagttccatggtgcctaaa 43 RNA PAT source 1..43 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatatagacagttccatggtgcctaaa 44 RNA PAT source 1..44 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatagtagacagttccatggtgcctaaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética gaagcctgccaattgacagttattagtagacagttccatggtgcctaaa 45 RNA PAT source 1..45 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaataagtagacagttccatggtgcctaaa 16 RNA PAT source 1..16 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctaaa 49 RNA PAT source 1..49 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaatatattagtagacagttccatggtgcctaaa 41 RNA PAT source 1..41 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgctagtagacagttccatggtgcctaaa 42 RNA PAT source 1..42 mol_type other RNA organism synthetic construct construcción sintética tgatctgaagcctgccaagtagacagttccatggtgcctaaa 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct construcción sintética acaacagggtgatcgtccgt 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct construcción sintética ggaactgtctactaatatat 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct construcción sintética accataaaggggatttgtga 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct construcción sintética atacaatggagaactagtta 20 RNA PAT source 1..20 mol_type other RNA organism synthetic construct construcción sintética cttgcaaggacttgatgata 40 RNA PAT source 1..40 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatctagttcttcttacgtaagattgatcata 28 RNA PAT source 1..28 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatctggaaactgatttctc 33 RNA PAT source 1..33 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatcttgacagtgaattccgtaacc 35 RNA PAT source 1..35 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatctgctgactacaaacagattgtcc 33 RNA PAT source 1..33 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatctcaggccttgcaccagatctt 28 RNA PAT source 1..28 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatctcaaaatccgccagtt 33 RNA PAT source 1..33 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatcttagtaatgtggagcaccttc 35 RNA PAT source 1..35 mol_type other RNA organism synthetic construct construcción sintética gctcttccgatcttaactatttggtagcagtagcc