P124383PCT EP 22174186 2022-05-18 F. Hoffmann-La Roche AG IMPROVED OLIGONUCLEOTIDES TARGETING RNA BINDING PROTEIN SITES OLIGONUCLEÓTIDOS MEJORADOS QUE ACTÚAN SOBRE SITIOS DE PROTEÍNA DE UNIÓN A ARN 126 10 DNA PAT source 1..10 mol_type other DNA organism synthetic construct constructo sintético acacacacac 11 DNA PAT source 1..11 mol_type other DNA organism synthetic construct constructo sintético acacacacaca 12 DNA PAT source 1..12 mol_type other DNA organism synthetic construct constructo sintético acacacacacac 13 DNA PAT source 1..13 mol_type other DNA organism synthetic construct constructo sintético acacacacacaca 16 DNA PAT source 1..16 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacac 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacac 10 DNA PAT source 1..10 mol_type other DNA organism synthetic construct constructo sintético cacacacaca 11 DNA PAT source 1..11 mol_type other DNA organism synthetic construct constructo sintético cacacacacac 12 DNA PAT source 1..12 mol_type other DNA organism synthetic construct constructo sintético cacacacacaca 13 DNA PAT source 1..13 mol_type other DNA organism synthetic construct constructo sintético cacacacacacac 16 DNA PAT source 1..16 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacaca 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacaca 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct constructo sintético tccacactgaacaaacc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacac 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacacacacac 24 DNA PAT source 1..24 mol_type other DNA organism synthetic construct constructo sintético cacacacacacaacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacacac 26 DNA PAT source 1..26 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacacacacacac 27 DNA PAT source 1..27 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacacacac 28 DNA PAT source 1..28 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacacacacac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacacacacacacacac 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacacacacacac 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacaccacacacacacacaca 34 DNA PAT source 1..34 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacacacacacacaca 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacaacacacacacacacacac 36 DNA PAT source 1..36 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacaccacacacacacacacaca 32 DNA PAT source 1..32 mol_type other DNA organism synthetic construct constructo sintético acacacacacacacacacacacacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 12 mod_base i cacacacccacncacacacgcac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 6 mod_base i cacacncacacacacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 12 mod_base i cacacacacacncacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 6 mod_base i cacacncacacacacacacactc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacatacacacccacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacgcacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 4 mod_base i modified_base 8 mod_base i modified_base 16 mod_base i modified_base 20 mod_base i cacncacncacacacncacncac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacactctcacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético ctcacacacacacacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacaaacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacgcacgcacacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacgcacacacccacacactcac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacactctctcacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético modified_base 14 mod_base i modified_base 16 mod_base i modified_base 18 mod_base i modified_base 20 mod_base i cacacacacacacncncncncac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cactcacacactcacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacgcacacacgcacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacccacacacccacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacgcacatacacacacccac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético ttcacacacacacacacacacac 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacacacaa 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético modified_base 21 mod_base i cacacacacacacacacacanacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético modified_base 5 mod_base i cacanacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético catacacacacacacacacatacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético caaacacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacactcacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacagacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacaaacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacatacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético catacgcacatacacgcacacacaaacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacatatacacatacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacacactctctctctc 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacgcacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético modified_base 17 mod_base i modified_base 19 mod_base i modified_base 21 mod_base i cacacacacacacacantntntcacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cgcacacacacacacacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacagacagacagacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacacaaaaaaacacacacacacac 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético cacacacacacccccccacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacactctctcacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacaaacacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cactcacacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacaaacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacccacacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético ctctctcacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético caaacacacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacccacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacccacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacacgcacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacacacactcacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacatacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacacacagacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético tttacacacacacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacgcacacgcacacacacacacac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacgcacacacgcacacacacgcac 25 DNA PAT source 1..25 mol_type other DNA organism synthetic construct constructo sintético cacacgcacacacacacacacacac 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct constructo sintético ccaaatcttataataactac 11 RNA PAT source 1..11 mol_type transcribed RNA organism unidentified sin identificar tgtgtgtgtgt 12 RNA PAT source 1..12 mol_type transcribed RNA organism Homo sapiens Homo sapiens tgtgtgtgtgtg 13 RNA PAT source 1..13 mol_type transcribed RNA organism unidentified sin identificar tgtgtgtgtgtgt 10 RNA PAT source 1..10 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgt 11 RNA PAT source 1..11 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgtg 12 RNA PAT source 1..12 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgtgt 13 RNA PAT source 1..13 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgtgtg 14 RNA PAT source 1..14 mol_type transcribed RNA organism unidentified sin identificar tgtgtgtgtgtgtg 14 RNA PAT source 1..14 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgtgtgt 18 RNA PAT source 1..18 mol_type transcribed RNA organism unidentified sin identificar tgtgtgtgtgtgtgtgtg 18 RNA PAT source 1..18 mol_type transcribed RNA organism unidentified sin identificar gtgtgtgtgtgtgtgtgt 10 RNA PAT source 1..10 mol_type transcribed RNA organism unidentified sin identificar tgtgtgtgtg 17 DNA PAT source 1..17 mol_type unassigned DNA organism unidentified sin identificar ggtttgttcagtgtgga 29 DNA PAT source 1..29 mol_type unassigned DNA organism unidentified sin identificar gtgtgtgtgtgtgtgtgtgtgtgtgtgtg 25 DNA PAT source 1..25 mol_type unassigned DNA organism unidentified sin identificar gtgtgtgtgtgtgtgtgtgtgtgtg 20 DNA PAT source 1..20 mol_type unassigned DNA organism unidentified sin identificar gtagttattataagatttgg 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct constructo sintético cagctcatcctcagtcatgtc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct constructo sintético gatggtgtgactgcaaacttc 23 DNA PAT source 1..23 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 5HEX linked at the 5' terminus 5HEX ligada al extremo 5' misc_feature 23 note 3IABkFQ linked at the 3' terminus 3IABkFQ ligada al extremo 3' cagcgccccacaaacacttttct 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct constructo sintético ctgctcagcgtctgc 15 DNA PAT source 1..15 mol_type other DNA organism synthetic construct constructo sintético gttgcgaggttccgg 35 DNA PAT source 1..35 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 5HEX is linked at the 5' terminus 5HEX está ligada al extremo 5' misc_feature 9^10 note ZEN between nucleotides 9 and 10 ZEN entre nucleótidos 9 y 10 misc_feature 35 note 3IABkFQ linked at the 3' terminus 3IABkFQ ligada al extremo 3' ctaaaacagcaatggcctacaaggaaaaaatgaag 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct constructo sintético cgagccctcggagtttg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct constructo sintético tccttccaagaaatggtggc 31 DNA PAT source 1..31 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 56-FAM linked at the 5' terminus 56-FAM ligada al extremo 5' misc_feature 9^10 note ZEN between nucleotides 9 and 10 ZEN entre nucleótidos 9 y 10 misc_feature 31 note 3IABkFQ linked at the 3' terminus 3IABkFQ ligada al extremo 3' cgacttccagaatatgatgctgctgctgatg 18 DNA PAT source 1..18 mol_type other DNA organism synthetic construct constructo sintético tctgagccaaacctgcac 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct constructo sintético atcagctctgtcagcttctcc 21 DNA PAT source 1..21 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 5HEX linked at the 5' terminus 5HEX ligada al extremo 5' misc_feature 9^10 note ZEN between nucleotides 9 and 10 ZEN entre nucleótidos 9 y 10 misc_feature 21 note 3IABkFQ linked at the 3' terminus 3IABkFQ ligada al extremo 3' cgaggctccgtggaacacacg 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct constructo sintético gatcaaaggcgaggagaagg 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct constructo sintético tggcatctgggatcttcac 30 DNA PAT source 1..30 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 56-FAM linked at 5' terminus 56-FAM ligada al extremo 5' misc_feature 9^10 note ZEN between nucleotides 9 and 10 ZEN entre nucleótidos 9 y 10 misc_feature 30 note 3IABkFQ linked at 3' terminus 3IABkFQ ligada al extremo 3' acctgtctgcatgagaacctgttccacttc 20 DNA PAT source 1..20 mol_type other DNA organism synthetic construct constructo sintético ctgacagtgccaataccacc 19 DNA PAT source 1..19 mol_type other DNA organism synthetic construct constructo sintético gctgctccgtggtcttaat 26 DNA PAT source 1..26 mol_type other DNA organism synthetic construct constructo sintético misc_feature 1 note 5Cy5 linked at 5' terminus 5Cy5 ligada al extremo 5' misc_feature 26 note 3IAbRQSp linked at 3' terminus 3IAbRQSp ligada al extremo 3' atgaagacgctaaagcccggaagcag 17 DNA PAT source 1..17 mol_type other DNA organism synthetic construct constructo sintético misc_feature order(1,2,14,15,16,17) note beta-D-oxy-LNA residues residuos beta-D-oxi-LNA modified_base 2 mod_base m5c modified_base 16 mod_base m5c modified_base 17 mod_base m5c misc_feature 1..17 note phosphorothioate linkages enlaces fosforotioato tccacactgaacaaacc 29 DNA PAT source 1..29 mol_type other DNA organism synthetic construct constructo sintético misc_feature order(1,2,4,6,8,10,12,14,16,18,20,22,24,26,28,29) note beta-D-oxy-LNA nucleosides nucleósidos de beta-D-oxi-LNA modified_base 1 mod_base m5c modified_base 29 mod_base m5c misc_feature 1..29 note phosphorothioate linkages enlaces fosforotioato cacacacacacacacacacacacacacac 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct constructo sintético misc_feature 1..25 note 2'-O-methoxyethyl-RNA nucleoside nucleósidos de 2'-O-metoxietil-ARN modified_base order(1,3,5,7,9,11,13,15,17,19,21,23,25) mod_base m5c misc_feature 1..25 note phosphorothioate linkages enlaces fosforotioato cacacacacacacacacacacacac 29 RNA PAT source 1..29 mol_type other RNA organism synthetic construct constructo sintético misc_feature 1..29 note 2'-O-methoxyethyl-RNA nucleoside nucleósidos de 2'-O-metoxietil-ARN modified_base order(1,3,5,7,9,11,13,15,17,19,21,23,25,27,29) mod_base m5c misc_feature 1..29 note phosphorothioate linkages enlaces fosforotioato cacacacacacacacacacacacacacac 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct constructo sintético misc_feature 1..25 note 2'-O-methoxyethyl-RNA nucleoside nucleósidos de 2'-O-metoxietil-ARN modified_base order(1,3,5,7,9,11,13,15,17,19,19,21,23,25) mod_base m5c misc_feature 1 note CholTEG linked at 5' terminus by a phosphorothioate linkage CholTEG ligado al extremo 5' mediante un enlace fosforotioato misc_feature 1..25 note phosphorothioate linkages enlaces fosforotioato cacacacacacacacacacacacac 25 RNA PAT source 1..25 mol_type other RNA organism synthetic construct constructo sintético misc_feature 1..25 note 2'-O-methoxyethyl-RNA nucleoside nucleósidos de 2'-O-metoxietil-ARN modified_base order(1,3,5,7,9,11,13,15,17,19,21,23,25) mod_base m5c misc_feature 1 note CholTEG linked at 5' terminus by a phosphate linkage CholTEG ligado al extremo 5' mediante un enlace fosfato misc_feature 1..25 note phosphorothioate linkages enlaces fosforotioato cacacacacacacacacacacacac 29 RNA PAT source 1..29 mol_type other RNA organism synthetic construct constructo sintético modified_base order(1,3,5,7,9,11,13,15,17,19,21,23,25,27,29) mod_base m5c misc_feature 1..29 note phosphorothioate linkages enlaces fosforotioato misc_feature 1 note CholTEG linked at 5' terminus by a phosphorothioate linkage CholTEG ligado al extremo 5' mediante un enlace fosforotioato cacacacacacacacacacacacacacac 29 RNA PAT source 1..29 mol_type other RNA organism synthetic construct constructo sintético misc_feature 1..29 note phosphorothioate linkages enlaces fosforotioato modified_base order(1,3,5,7,9,11,13,15,17,19,21,23,25,27,29) mod_base m5c misc_feature 1 note CholTEG linked at 5' terminus by a phosphate linker CholTEG ligado al extremo 5' mediante un conector de fosfato cacacacacacacacacacacacacacac 20 DNA PAT misc_feature 1..20 note phosphorothioate linkages enlaces fosforotioato source 1..20 mol_type other DNA organism synthetic construct constructo sintético misc_feature order(1,3,4,5,16,17,19,20) note beta-D-oxy-LNA nucleosides nucleósidos de beta-D-oxi-LNA modified_base order(1,17,20) mod_base m5c ccaaatcttataataactac